View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0381_low_4 (Length: 251)
Name: NF0381_low_4
Description: NF0381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0381_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 241
Target Start/End: Complemental strand, 502231 - 502020
Alignment:
Q |
30 |
tatattcgctttatatattggtatagattaaaaataagttataagcttaatttgtgggaaaaatttgaatcaaaccgatctatctttgtaatacaacctt |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
502231 |
tatattcgctttatatattggtatagattaaaaataagttataagcttaatttgtgggaaaaatttgaatcaaaccgatctatctttgttatacaacctt |
502132 |
T |
 |
Q |
130 |
attagcaaaaatgctagaaaactcatcttaccaaatagacccatggataatactttgtaaacacaatagaagtttcgattaatgtaactatcagagacgt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
502131 |
attagcaaaaatgctagaaaactcatcttaccaaatagacccatggataatactttgtaaacacaatagaagtttcgattaatgtaactatcagagacgt |
502032 |
T |
 |
Q |
230 |
gataaatgagta |
241 |
Q |
|
|
|||||||||||| |
|
|
T |
502031 |
gataaatgagta |
502020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 808 times since January 2019
Visitors: 3065