View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_high_3 (Length: 474)
Name: NF0383_high_3
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0383_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 94 - 271
Target Start/End: Complemental strand, 38569234 - 38569049
Alignment:
Q |
94 |
gcatcaaattaccacaatttcgaagatcaataaatttaattgatctctcttgt--attctagttgatattttgattgatgcttt-----atatgttgatt |
186 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
38569234 |
gcatcaaattaccacgatttcgaagatcaataaattagcttgatctctcttgtttattctagttgatattttgattgatgcttttatttatatgttgatt |
38569135 |
T |
 |
Q |
187 |
attatctgaagataattttatacttcaactacaaaaatactataaca-acatgggcagggaaattcattgttgcacactttcaccc |
271 |
Q |
|
|
||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
38569134 |
attatttggagataattttatacttcaactacaaaaatactataacatacatgggcagggaaattcattgttgcacactttcaccc |
38569049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 329 - 466
Target Start/End: Complemental strand, 38568948 - 38568814
Alignment:
Q |
329 |
gacagaatattgggctttttcttacgagaagaagaagattgggggatataccaataaatttcaacctatcaatttcttatttctttcannnnnnnnnnng |
428 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
38568948 |
gacagaatattgggctttttcttacgagaagaagaagattggg--atataccaataaatttcaacctatcaatttcttatttctttca-ttttttttttg |
38568852 |
T |
 |
Q |
429 |
gtcagtcttatttctttcattttattgtgctctctgct |
466 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| |
|
|
T |
38568851 |
gtcagtcttatttctttcattttattgtgctctttgct |
38568814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1248 times since January 2019
Visitors: 3078