View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_high_5 (Length: 300)
Name: NF0383_high_5
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0383_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 47493382 - 47493124
Alignment:
| Q |
14 |
gaagggaccgcatcaagaaaatcccaaaatatgaactttttgaagttttaacaattttatgtgaagattatgtgttgtctttctttgttactttttgcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47493382 |
gaagggaccgcatcaagaaaatcccaaaatttgaactttttgaagttttaacaattttatgtgaagattatgtgttgtctttctttgttactttttgcaa |
47493283 |
T |
 |
| Q |
114 |
tagtatcatatcaccaagagagagaggggggaaaacttacaacagataagtattgattgttactagacaaaaaattgttttgtaattggatttattggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47493282 |
tagtatcatatcaccaagagagagaggggggaaaacttacaacagataagtattgattgttactagacaaaaaattgttttggaattggatttattggtt |
47493183 |
T |
 |
| Q |
214 |
ttacagctaggaaatggaggaaacaagaatacaaattcaggttttgggatacatatagt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47493182 |
ttacagctaggaaatggaggaaacaagaatacaaattcaggttttgggatacatatagt |
47493124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University