View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0383_high_6 (Length: 295)

Name: NF0383_high_6
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0383_high_6
NF0383_high_6
[»] chr3 (1 HSPs)
chr3 (14-272)||(47493124-47493382)


Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 47493382 - 47493124
Alignment:
14 gaagggaccgcatcaagaaaatcccaaaatatgaactttttgaagttttaacaattttatgtgaagattatgtgttgtctttctttgttactttttgcaa 113  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47493382 gaagggaccgcatcaagaaaatcccaaaatttgaactttttgaagttttaacaattttatgtgaagattatgtgttgtctttctttgttactttttgcaa 47493283  T
114 tagtatcatatcaccaagagagagaggggggaaaacttacaacagataagtattgattgttactagacaaaaaattgttttgtaattggatttattggtt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
47493282 tagtatcatatcaccaagagagagaggggggaaaacttacaacagataagtattgattgttactagacaaaaaattgttttggaattggatttattggtt 47493183  T
214 ttacagctaggaaatggaggaaacaagaatacaaattcaggttttgggatacatatagt 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47493182 ttacagctaggaaatggaggaaacaagaatacaaattcaggttttgggatacatatagt 47493124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1855 times since January 2019
Visitors: 3091