View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_low_13 (Length: 275)
Name: NF0383_low_13
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0383_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 47 - 243
Target Start/End: Original strand, 22443397 - 22443590
Alignment:
Q |
47 |
atcatcaaaagtgtcttcggaagaacttaaaataaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtac |
146 |
Q |
|
|
|||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22443397 |
atcagcaaaagtgtcttcggaa---cttaaaaaaaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtac |
22443493 |
T |
 |
Q |
147 |
ttgcaaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatattcttcgaca |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
22443494 |
ttgcaaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatatggttcgaca |
22443590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University