View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_low_14 (Length: 264)
Name: NF0383_low_14
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0383_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 45 - 163
Target Start/End: Original strand, 15797522 - 15797640
Alignment:
| Q |
45 |
ttaataattgctaatgctataaccctgcccttttattcaacagtttgcatggattggttaggggagaaaacatggagcttggtcgagattctgacaccgg |
144 |
Q |
| |
|
|||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15797522 |
ttaatagttgctaatgctataacctttttcttttattcaacagtttgcatggattggttaggggagaaaacatggagcttggtcgagattctgacaccgg |
15797621 |
T |
 |
| Q |
145 |
tggacaggtatttgacatt |
163 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15797622 |
tggacaggtatttgacatt |
15797640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 84 - 169
Target Start/End: Original strand, 39810177 - 39810262
Alignment:
| Q |
84 |
acagtttgcatggattggttaggggagaaaacatggagcttggtcgagattctgacaccggtggacaggtatttgacattcctaca |
169 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |||||||||| || |||||||||||| |||| |||| |||| |
|
|
| T |
39810177 |
acagtttgcatggattggtacgaggagaaaacatggagcttggtagagattctgatactggtggacaggtacttgatattcataca |
39810262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University