View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_low_16 (Length: 252)
Name: NF0383_low_16
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0383_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 30 - 184
Target Start/End: Original strand, 34476579 - 34476733
Alignment:
| Q |
30 |
aaaagtaagattggttgacctaattttaggtttactcattttttagaaggtcttggcactcccctttggtttnnnnnnnntaaagtttggcataaaagtg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34476579 |
aaaagtaagattggttgacctaattttaggtttactcattttttagaaggtcttggcactcccctttggttttaaaaaaataaagtttggcataaaagtg |
34476678 |
T |
 |
| Q |
130 |
gttggaaccgaattaggatgtaacgagttaaaggagttgtgtgcttcactaatga |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34476679 |
gttggaaccgaattaggatgtaacgagttaaaggagttgtgtacttcactaatga |
34476733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 83
Target Start/End: Complemental strand, 22808321 - 22808278
Alignment:
| Q |
40 |
ttggttgacctaattttaggtttactcattttttagaaggtctt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| | || |||||||||| |
|
|
| T |
22808321 |
ttggttgacctaattttaggtttactcactcttgagaaggtctt |
22808278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University