View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_low_18 (Length: 247)
Name: NF0383_low_18
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0383_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 13 - 184
Target Start/End: Complemental strand, 34480289 - 34480121
Alignment:
Q |
13 |
tgaataacgaattataagaagaaaaaagaatcaaaattttttcttctgttaatatatttatattttaatactgctttttgtggatcaagtgttactgcaa |
112 |
Q |
|
|
||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
T |
34480289 |
tgaataacgaattataaaaagaaaaaagaatcaatttttttttttctgttaatatatttatattttaatactgcttttagtggatcaagtgttactgc-a |
34480191 |
T |
 |
Q |
113 |
actattttagagatgcatgcatacatacatgtcacttttgaacttttgagatttatagacagtgcgttgttt |
184 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||| |||||||||||| |
|
|
T |
34480190 |
actattttagagatgc--gcatacatacatgtcacttttgaacttttgcgatttgtagagagtgcgttgttt |
34480121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 34476893 - 34476837
Alignment:
Q |
191 |
atgttcgaaagagagtgttgatagcattacttaaaatagaatgaaagagattttagt |
247 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
34476893 |
atgttcgaaagagagtgttgatagcattactaaaaatagaatgaaagagattttagt |
34476837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University