View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_low_19 (Length: 206)
Name: NF0383_low_19
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0383_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 49437390 - 49437264
Alignment:
| Q |
1 |
attctatctcaataagatcttccatttgaaagatccttatgttttaaaatagttttttagccttggttagctcatcggtccacagctctgttttttgagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437390 |
attctatctcaataagatcttccatttgaaagatctttatgttttaaaatagttttttacccttggttagctcatcggtccacagctctgttttttgagt |
49437291 |
T |
 |
| Q |
101 |
acaagtaaatacactctatattcttcg |
127 |
Q |
| |
|
|||| |||||||||||||||| |||| |
|
|
| T |
49437290 |
tcaagaaaatacactctatattgttcg |
49437264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University