View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0383_low_7 (Length: 319)
Name: NF0383_low_7
Description: NF0383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0383_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 99 - 236
Target Start/End: Complemental strand, 53842809 - 53842672
Alignment:
| Q |
99 |
aaacaaacataacaaacagcgttgaagatgataaagagtcctacaaaatcaatgtatccatttactaaacggttttctgatattaattggcgtatccttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842809 |
aaacaaacataacaaacagcgttgaagatgataaagagtcctacaaaatcaatgtatccatttactaaacggttttctgatattaattggcgtatccttg |
53842710 |
T |
 |
| Q |
199 |
tgttgataattcctcttttttcttttatcatattcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842709 |
tgttgataattcctcttttttcttttatcatattcttc |
53842672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 236
Target Start/End: Complemental strand, 53844453 - 53844372
Alignment:
| Q |
155 |
tccatttactaaacggttttctgatattaattggcgtatccttgtgttgataattcctcttttttcttttatcatattcttc |
236 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||| || || || |||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
53844453 |
tccaattaataaatggttttctgatattaattggggtctcgttatgttgataatccctctactttctattatcatattcttc |
53844372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University