View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0384-INSERTION-3 (Length: 121)
Name: NF0384-INSERTION-3
Description: NF0384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0384-INSERTION-3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 2e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 5 - 82
Target Start/End: Original strand, 12473354 - 12473431
Alignment:
Q |
5 |
tctgagtcaacaatatgtttgcttatggatagatttgtgccttgctaaaatatgttgtttattcaaatatatcaatgt |
82 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
12473354 |
tctgagtcaacaatatgtttgcttatggatagatttgtgccttgctaaaatatgttgtttattcaactatatcaatgt |
12473431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 12457300 - 12457350
Alignment:
Q |
8 |
gagtcaacaatatgtttgcttatggatagatttgtgccttgctaaaatatg |
58 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
T |
12457300 |
gagtcaacaatatgtttgcttatggatagatttgtgccctgctaatatatg |
12457350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 80 - 116
Target Start/End: Original strand, 12473457 - 12473492
Alignment:
Q |
80 |
tgtaatgaaatgttatatatgttgtgtttagtataat |
116 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||| |
|
|
T |
12473457 |
tgtaatgaaatgttatatatgttgtg-ttagtataat |
12473492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University