View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0384_high_6 (Length: 240)
Name: NF0384_high_6
Description: NF0384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0384_high_6 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 36998962 - 36998739
Alignment:
Q |
17 |
cctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaatgcggcggtcaaac |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36998962 |
cctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaatgcggcggtcaaac |
36998863 |
T |
 |
Q |
117 |
agacgaccactgctgcggctgggcatatgggtcagccccaccacaccacagggacgactggaacggggaccgccacataatctaccaatgggaaatatgt |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||| |
|
|
T |
36998862 |
agacgaccactgctgcggctgggcatatgggtcagccccaccacaccacagggacgactggaacggggaccgccacatactctaccactgggaattatgg |
36998763 |
T |
 |
Q |
217 |
acatcccacttgggcacatcagat |
240 |
Q |
|
|
|||||||||| ||||||||||||| |
|
|
T |
36998762 |
acatcccactggggcacatcagat |
36998739 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 36994151 - 36994070
Alignment:
Q |
21 |
tgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcagcacgtgaacacaa |
102 |
Q |
|
|
|||||||||||||||||||||| |||||||| | || | | |||||||| ||||| ||||| ||| || ||||||||||| |
|
|
T |
36994151 |
tgcaaaaagagatggcaacccaaaagaaagaagaaagggttaaccaggctgagcttgataaagaggcggcgcgtgaacacaa |
36994070 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University