View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0385_low_5 (Length: 316)
Name: NF0385_low_5
Description: NF0385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0385_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 90 - 244
Target Start/End: Original strand, 39865346 - 39865500
Alignment:
| Q |
90 |
cagtcctgagcatgagagttgagttagatcaaatcgaaattctaaacaagtgagagtatattagcagtctccggcaggcatttttgatacatgtaggatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39865346 |
cagtcctgagcatgagagttgagttagatcaaatcgaaattctaaacaagtgagagtatattagcagtctccggcaggcatttttgatacatgtaggatg |
39865445 |
T |
|
| Q |
190 |
tagctgatttcacctagtgggaaaaagctttggttgttgtagacgtagtagtata |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39865446 |
tagctgatttcacctagtgggaaaaagctttggttgttgtagacgtagtagtata |
39865500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 519 times since January 2019
Visitors: 3060