View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0385_low_8 (Length: 294)
Name: NF0385_low_8
Description: NF0385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0385_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 73 - 254
Target Start/End: Complemental strand, 23446467 - 23446280
Alignment:
| Q |
73 |
tatagctcattctaaagaatttaatcttaggaacttagtacctatcatgaggatgttattgatggatacaagcatgcca------agcaattaatagggt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23446467 |
tatagctcattctaaagaatttaatcttaagaacttagtacctatcatgaggatgttattgatggatacaagcatgccactaacaagcaattaatagggt |
23446368 |
T |
|
| Q |
167 |
acaaaaacaattaatgactttcaactgaaagcatacttcatgttctggccaaatgcctcataactcattaggtatatacaaaacagta |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
23446367 |
acaaaaacaattaatgactttcaactgaaagcatacttcatgttctggccaaatgcttcatgactcattaggtatatgcaaaacagta |
23446280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 338 times since January 2019
Visitors: 3059