View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0385_low_9 (Length: 291)
Name: NF0385_low_9
Description: NF0385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0385_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 71 - 241
Target Start/End: Complemental strand, 47619504 - 47619334
Alignment:
| Q |
71 |
gtaattaatgtcactcattcattattgataacccaattgttctaaattgacatggttacgttgaaaactttaatattgtagcaatagcaatgcaaacaaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619504 |
gtaattaatgtcactcattcattattgataacccaattgttctaaattgacatggttacgttgaaaactttaatattgtagcaatagcaatgcaaacaaa |
47619405 |
T |
|
| Q |
171 |
tgcagccaatgcggctgcaattgtgattgcgatcatgtttttgagacttctaatatatttatactagaatt |
241 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619404 |
tgcagccaatgaggctgcaattgtgattgcgatcatgtttttgagacttctaatatatttatactagaatt |
47619334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 828 times since January 2019
Visitors: 3069