View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0390_high_12 (Length: 212)

Name: NF0390_high_12
Description: NF0390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0390_high_12
NF0390_high_12
[»] chr4 (2 HSPs)
chr4 (76-183)||(34695237-34695344)
chr4 (1-78)||(34697071-34697148)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 76 - 183
Target Start/End: Complemental strand, 34695344 - 34695237
Alignment:
76 gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaatgaatatttattaccttgaaattgatcaccagtaaag 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
34695344 gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaattaatatttattaccttgaaattgatcaccagtaaag 34695245  T
176 aggaatgg 183  Q
    ||||||||    
34695244 aggaatgg 34695237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 34697148 - 34697071
Alignment:
1 tataggaaatttagagtttgacacataagtaaagtttgatnnnnnnnttgttcaaactaggatttaaatcagtttgtt 78  Q
    |||||| |||||||||||||||||||||||||||||||||       ||||| |||||||||||||||||||||||||    
34697148 tataggtaatttagagtttgacacataagtaaagtttgataaaaaaattgttaaaactaggatttaaatcagtttgtt 34697071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1854 times since January 2019
Visitors: 3091