View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0390_high_9 (Length: 220)
Name: NF0390_high_9
Description: NF0390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0390_high_9 |
 |  |
|
[»] scaffold1254 (1 HSPs) |
 |  |  |
|
[»] scaffold0419 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 27605136 - 27605321
Alignment:
Q |
22 |
atttggagtctttaatataacaaggagaaattgttcttaagaaatagttatttttgtcataagtttttgcggtctgtgttgacaaaaatggtttgtgaaa |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27605136 |
atttggagtctttaatataacaaggagaaattgttcttaataaatagttattttggtcataagtttttgcggtctgtgttgacaaaaatggtttgtgaaa |
27605235 |
T |
 |
Q |
122 |
cttcctggtcacttcctatctatagccgtgtggaccaatcacatactaaatatcactgtactacacttcttcttgctatattcttc |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
27605236 |
cttcctggtcacttcctatctatagccgtgtggaccaatcacatactaaatatcactgtactacacttcttcttgctaaattcttc |
27605321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 209
Target Start/End: Original strand, 27586215 - 27586314
Alignment:
Q |
107 |
aaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatcacatactaaatatcactgtacta-cacttcttcttgctatattct |
205 |
Q |
|
|
||||||| ||||||||||||||| ||||| | |||||||||||||||||||||||||||||||| ||||||||| | | ||||||||||| |||| |
|
|
T |
27586215 |
aaatggtatgtgaaacttcctggccactt----tgaatagccgtgtggaccaatcacatactaaatataactgtactaccgcctcttcttgctaatttct |
27586310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 27338528 - 27338586
Alignment:
Q |
101 |
tgacaaaaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatcac |
163 |
Q |
|
|
||||||||||| ||||||||||||| ||| |||||| ||||||||||||||||||||||| |
|
|
T |
27338528 |
tgacaaaaatgatttgtgaaacttcttggccacttc----ctatagccgtgtggaccaatcac |
27338586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 27399268 - 27399326
Alignment:
Q |
101 |
tgacaaaaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatcac |
163 |
Q |
|
|
||||||||||| ||||||||||||| ||| |||||| ||||||||||||||||||||||| |
|
|
T |
27399268 |
tgacaaaaatgatttgtgaaacttcttggccacttc----ctatagccgtgtggaccaatcac |
27399326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 186
Target Start/End: Original strand, 27531644 - 27531724
Alignment:
Q |
102 |
gacaaaaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatcacatactaaatatcactgtactaca |
186 |
Q |
|
|
|||||||||| | ||||||||||||||| ||||||||| |||||||||||||||||| | | |||||| || ||||||||| |
|
|
T |
27531644 |
gacaaaaatgatatgtgaaacttcctggcaacttcctat----agccgtgtggaccaatcatacattaaataacattgtactaca |
27531724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 26655669 - 26655627
Alignment:
Q |
142 |
tatagccgtgtggacc-aatcacatactaaatatcactgtact |
183 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||| |||||| |
|
|
T |
26655669 |
tatagccgtgtggacccaatcacatactaaatatcattgtact |
26655627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 26761640 - 26761598
Alignment:
Q |
142 |
tatagccgtgtggacc-aatcacatactaaatatcactgtact |
183 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||| |||||| |
|
|
T |
26761640 |
tatagccgtgtggacccaatcacatactaaatatcattgtact |
26761598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1254 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1254
Description:
Target: scaffold1254; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 380 - 437
Alignment:
Q |
101 |
tgacaaaaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatca |
162 |
Q |
|
|
||||||||||||| ||||||||||| ||| |||||| |||||||||||||||||||||| |
|
|
T |
380 |
tgacaaaaatggtctgtgaaacttcttggccacttc----ctatagccgtgtggaccaatca |
437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0419 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0419
Description:
Target: scaffold0419; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 7249 - 7192
Alignment:
Q |
101 |
tgacaaaaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatca |
162 |
Q |
|
|
||||||||||||| ||||||||||| ||| |||||| |||||||||||||||||||||| |
|
|
T |
7249 |
tgacaaaaatggtctgtgaaacttcttggccacttc----ctatagccgtgtggaccaatca |
7192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 164
Target Start/End: Original strand, 18724519 - 18724578
Alignment:
Q |
101 |
tgacaaaaatggtttgtgaaacttcctggtcacttcctatctatagccgtgtggaccaatcaca |
164 |
Q |
|
|
||||||||||||| ||| |||||||||| |||||| |||||||||||||||||||||||| |
|
|
T |
18724519 |
tgacaaaaatggtctgttaaacttcctgaccacttc----ctatagccgtgtggaccaatcaca |
18724578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University