View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0391-Insertion-3 (Length: 186)
Name: NF0391-Insertion-3
Description: NF0391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0391-Insertion-3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 5171509 - 5171405
Alignment:
| Q |
8 |
tatataaataatttcctttcatttctccattttcagtttttgttctctctacaatcgttcacactcccttctttctacatatttcttacttaatttttac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5171509 |
tatataaataatttcctttcatttctccattttcagtttttgttctccctacaatcgttcacactcccttctttctacatatttcttacttaatttttac |
5171410 |
T |
 |
| Q |
108 |
tacaa |
112 |
Q |
| |
|
||||| |
|
|
| T |
5171409 |
tacaa |
5171405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 171
Target Start/End: Complemental strand, 5171389 - 5171349
Alignment:
| Q |
131 |
aagtttcgatctctaagtacaaagtattgttgtaacattta |
171 |
Q |
| |
|
||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
5171389 |
aagtttcaatttctaagtacaaaatattgttgtaacattta |
5171349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University