View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0391_high_2 (Length: 313)
Name: NF0391_high_2
Description: NF0391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0391_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 309
Target Start/End: Complemental strand, 25707483 - 25707216
Alignment:
| Q |
30 |
gcaattggacctgtagctgtagtgtctatgcttttatcttccttggtcaccaatgtcatagatcctgttgctaatcctcatgcctatagagattttatct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25707483 |
gcaattggacctgtagctgtagtgtctatgcttttatcttccttggtcaccaatgtcatagatcctgttgctaatcctcatgcctatagagattttatct |
25707384 |
T |
 |
| Q |
130 |
ttaccgtcaccttcttcgccggaatttttcaagctgcatttggtattttcaggtgctggttttctcattagcatgcaatatttcttgtgaatttcttgta |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25707383 |
ttaccgtcaccttcttcaccggaatttttcaagctgcatttggtattttcaggtgctggttttctcattagcatgcaaaattt------------ttgta |
25707296 |
T |
 |
| Q |
230 |
aattttctgttttgcccttataaaccaaatagtttgtttatttatccttcaatattttcgggttgggttttcttgtggat |
309 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
25707295 |
aattttctgttttgtccttataaaccaaatagtttgtttatttatccttcaatatttacaggttgggttttcttgtggat |
25707216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University