View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0392_low_2 (Length: 428)
Name: NF0392_low_2
Description: NF0392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0392_low_2 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 29 - 428
Target Start/End: Original strand, 30704025 - 30704427
Alignment:
Q |
29 |
aagtccactattcagttaaggaccaataagacgtccacttacagttgaataatacttgcaccggtgaagagctgcatcgcaccaaatgctacgctcagag |
128 |
Q |
|
|
||||||||||||||| ||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
30704025 |
aagtccactattcagctaaggcccaataagacgtccacttatagttgaagaatacttgcaccggtgaagagctgcatcgcaccaaatgctacactcagag |
30704124 |
T |
 |
Q |
129 |
cacctatgaaatatccacttgatacaacgatagcccgagcgaagcgttgtaagggaaaaactatcat--ccacgcataagggtctataaatagggtatgc |
226 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||| || ||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
30704125 |
cacctatgaaatatccacttgatacaacggtagcccgagcgaagcgctgcaagggcaaaactatcatatccacgcataagggtctataaatagggtatgc |
30704224 |
T |
 |
Q |
227 |
gtcaccgaaa-gcaaggtacgcattctaagaaatatcgtaaaatctcattgaaacctcgctgacttgagcgttgaagtgtcttttattggtacaccttct |
325 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
30704225 |
gtcaccgaaaagcaaggtacgcattctaagaaatatcgtaaaatctcattgaaacctcgctgacttgagcgttgaagtgtcttttattgatacaccttct |
30704324 |
T |
 |
Q |
326 |
gcattagggaaggatttacttcaaccattgtgaaccaccgcggcagttgattcgcaccaccaccgggcaccggccaactcttctattccttgataagaac |
425 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
30704325 |
gcattagggaaggatttacttcaaccattgtgaaccaccgcggcagttgattcgcaccaccaccgggcaccagccaactcttctattccttgataagaac |
30704424 |
T |
 |
Q |
426 |
agt |
428 |
Q |
|
|
||| |
|
|
T |
30704425 |
agt |
30704427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 49441618 - 49441581
Alignment:
Q |
284 |
gctgacttgagcgttgaagtgtcttttattggtacacc |
321 |
Q |
|
|
||||||||||||||||||||||||||| | |||||||| |
|
|
T |
49441618 |
gctgacttgagcgttgaagtgtcttttgtaggtacacc |
49441581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 978 times since January 2019
Visitors: 3074