View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0394_low_5 (Length: 251)
Name: NF0394_low_5
Description: NF0394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0394_low_5 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 998725 - 998504
Alignment:
Q |
30 |
ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaaggatttgatcctcaagataagaatcttcttt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
998725 |
ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaagtatttgatcctcaagataagaatcttcttt |
998626 |
T |
 |
Q |
130 |
attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttcnnnnnnnctcttccttatttcaaccacaaatcatattgtttagc |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
998625 |
attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttctttttttatcttccttatttcaaccacaaatcatattgtttagc |
998526 |
T |
 |
Q |
230 |
catagataacgatctagagaag |
251 |
Q |
|
|
|||||||||| |||||| |||| |
|
|
T |
998525 |
catagataacaatctagcgaag |
998504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 653 times since January 2019
Visitors: 3063