View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0395_low_9 (Length: 266)
Name: NF0395_low_9
Description: NF0395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0395_low_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 26 - 266
Target Start/End: Complemental strand, 2490934 - 2490694
Alignment:
| Q |
26 |
caaaggcctaagggtaataactctttcctgctcaacctcctctttcgcatcctgagcatcttggctattttgtccttcggcatctttcttctttttctgc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490934 |
caaaggcctaagggtaataactctttcctgctcaacttcctctttcgcatcctgagcatcttggctattttgtccttcggcatctttcttctttttctgc |
2490835 |
T |
 |
| Q |
126 |
tgtcgaaaacaaatatagcaatcagcatgataatcataggataataggattatagtaaatctttagagaaattgccaagttaccgaatccttttgtatct |
225 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490834 |
tgccgaaaacaaatatagcaatcagcatgataatcataggataataggattatagtaaatctttagagaaattgccaagttaccgaatccttttgtatct |
2490735 |
T |
 |
| Q |
226 |
cttgctgaattagctctctaacaggtctataagcagcggtt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490734 |
cttgctgaattagctctctaacaggtctataagcagcggtt |
2490694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University