View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0396_low_6 (Length: 228)
Name: NF0396_low_6
Description: NF0396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0396_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 51 - 217
Target Start/End: Original strand, 46677291 - 46677457
Alignment:
| Q |
51 |
agaagcttggggaaattcgtgtacatgaaacactcacaaatattgtgatccccacgtttgacataaaaacatcgcaaccaatcattttctcatcttataa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46677291 |
agaagcttggggaaattcgtgtacatgaaacactcacaaatattgtgatccccacgtttgacataaaaacatcgcaaccaatcattttctcatcttataa |
46677390 |
T |
 |
| Q |
151 |
gatcaagaacgccccttgcatggatgctcgactctcggacatatgcatcagtacctctgctgctcct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46677391 |
gatcaagaacgccccttgcatggatgctcgactctcggacatatgcatcagtacctctgctgctcct |
46677457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 59 - 213
Target Start/End: Original strand, 46681276 - 46681430
Alignment:
| Q |
59 |
ggggaaattcgtgtacatgaaacactcacaaatattgtgatccccacgtttgacataaaaacatcgcaaccaatcattttctcatcttataagatcaaga |
158 |
Q |
| |
|
|||||||||||||| || || || || || ||||||||||| ||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46681276 |
ggggaaattcgtgtgcacgagacgctgaccaatattgtgattcccacatttgacataaaaacaatgcaaccaattattttctcatcttataagatcaaga |
46681375 |
T |
 |
| Q |
159 |
acgccccttgcatggatgctcgactctcggacatatgcatcagtacctctgctgc |
213 |
Q |
| |
|
| | || |||||||||||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
46681376 |
aaactccatgcatggatgctcgactctcagacatatgtatcagcacctctgctgc |
46681430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University