View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0397_high_6 (Length: 254)
Name: NF0397_high_6
Description: NF0397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0397_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 33958008 - 33958197
Alignment:
| Q |
14 |
agatgaaaagaagacacaaaattagctaaatcaaacttttattatgcttgttttaccctatgtttacaagcttat-nnnnnnnnnnttgaatatattgnn |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33958008 |
agatgaaaagaagacacaaaattagctaaatcaaacttttaatatgctcgttttaccctatgtttacaagcttatgaaataaatatttgaatatattatt |
33958107 |
T |
 |
| Q |
113 |
nnnnnacaaattattattacttgcggatagatttacagggtaagtttagaattaccaacnnnnnnnccttttggttcaacttcataatatata |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33958108 |
tttttacaa---attattacttgcggatagatttacagggtaagtttagaattaccaactttttttccttttggttcaacttcataatatata |
33958197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University