View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0397_low_6 (Length: 254)

Name: NF0397_low_6
Description: NF0397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0397_low_6
NF0397_low_6
[»] chr7 (1 HSPs)
chr7 (14-205)||(33958008-33958197)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 33958008 - 33958197
Alignment:
14 agatgaaaagaagacacaaaattagctaaatcaaacttttattatgcttgttttaccctatgtttacaagcttat-nnnnnnnnnnttgaatatattgnn 112  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||           |||||||||||       
33958008 agatgaaaagaagacacaaaattagctaaatcaaacttttaatatgctcgttttaccctatgtttacaagcttatgaaataaatatttgaatatattatt 33958107  T
113 nnnnnacaaattattattacttgcggatagatttacagggtaagtttagaattaccaacnnnnnnnccttttggttcaacttcataatatata 205  Q
         ||||   |||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
33958108 tttttacaa---attattacttgcggatagatttacagggtaagtttagaattaccaactttttttccttttggttcaacttcataatatata 33958197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University