View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0398_high_8 (Length: 281)
Name: NF0398_high_8
Description: NF0398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0398_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 18841916 - 18842121
Alignment:
| Q |
1 |
tttactatgacataaaaacttgtaagatgatagttttagcttgtaggttgtttaggattggactataaagtaaacaagggaagaagtttcttcaagcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18841916 |
tttactatgacataaaaacttgtaagatgatagttttagcttgtaggttgtttaggataggactataaagtaaacaagggaagaagtttcttcaagcttt |
18842015 |
T |
|
| Q |
101 |
ctgttgaaaacacatttacaattgtcaaaaagtacattttaatgccagaaacaaaggaattgatcttgcatattgttctcatcattcttctgaccttgat |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18842016 |
ctgttgaaaacacatttaaaattgtcaaaaagtacattttaatgccagaaacaaaggaattgatcttgcatattgttctcatcattcttctgaccttgat |
18842115 |
T |
|
| Q |
201 |
tataaa |
206 |
Q |
| |
|
|||||| |
|
|
| T |
18842116 |
tataaa |
18842121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 310 times since January 2019
Visitors: 3059