View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0398_low_9 (Length: 310)
Name: NF0398_low_9
Description: NF0398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0398_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 53 - 290
Target Start/End: Complemental strand, 34899975 - 34899738
Alignment:
Q |
53 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
152 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
34899876 |
T |
 |
Q |
153 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
252 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34899875 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
34899776 |
T |
 |
Q |
253 |
atgtgaatttgtgcagatgatatcactgacaatatgat |
290 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
34899775 |
atgtgaatttgtgcagatgatatcactgacaatatgat |
34899738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 877 times since January 2019
Visitors: 3069