View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0400_high_4 (Length: 309)
Name: NF0400_high_4
Description: NF0400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0400_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 20 - 300
Target Start/End: Original strand, 42062752 - 42063032
Alignment:
| Q |
20 |
catcatcataccaatctgatcagctaagtaatgaacgtaactcagccttccgctggaagcatcccaactgaaatgaatacgaaggatgagggggagggtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42062752 |
catcatcataccaatctgatcagctaagtaatgaacgtaactcagccttccgctggaagcatcccaactgaaatgaatacgaaagatgagggggagggtg |
42062851 |
T |
 |
| Q |
120 |
agttacttcacattaatgggaaacctatcaagggaaattttagactttgaaccaaaaggacttcgcattgcactctttcttcactttatcctcttattgc |
219 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
42062852 |
agttgcttcacaataatgggaaacctatcaagggaaattttagactttgaaccaaaagaactttgccttgcactctttcttcactttatcctcttattgc |
42062951 |
T |
 |
| Q |
220 |
tgcaaagatccctctccagtgtcaactatcactgagatatggagaatcagtactagttatgtgatccattacacaaactca |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062952 |
tacaaagatccctctccagtgtcaactatcactgagatatggagaatcagtactagttatgtgatccattacacaaactca |
42063032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University