View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0401_high_5 (Length: 285)
Name: NF0401_high_5
Description: NF0401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0401_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 52977228 - 52977442
Alignment:
| Q |
1 |
agtatattgtctaaatcatcttctataagtatcttcccccttcattttaaagtatggttgttgatcgcttcatacatatcggtgtataaaaagaattaag |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52977228 |
agtatattgtctaaatcatcttctgtaagtatcttcccccttcatttttaagtatggttgt-gatcgcttcatacatatcggtgtataaaaagaattaag |
52977326 |
T |
|
| Q |
101 |
tctatcgtctaattcatcttttataagtatacttcctccgctttttagtatcgttggagtgtactaatcctaaggtttcagactcaattttcatcagtgt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||| | |
|
|
| T |
52977327 |
tctattgtctaattcatcttttataagtatacttcctccgctttttagtatcgttggagtgtactaatcttaaggtttcagattcgattttcatcagtat |
52977426 |
T |
|
| Q |
201 |
caatttcgatgagtta |
216 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
52977427 |
taattttgatgagtta |
52977442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1065 times since January 2019
Visitors: 3075