View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0401_high_6 (Length: 277)
Name: NF0401_high_6
Description: NF0401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0401_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 45546522 - 45546703
Alignment:
Q |
1 |
tctggtccatgtgtcaatgtcactgcatccaaaatagattcaaataaagtagnnnnnnntgcttcaaacttaaaaactaccaagtattgtatatattaac |
100 |
Q |
|
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
45546522 |
tctggtccatgtgtcagtgtcacttcatccaaaatagattcaaataaagtagaaaaaaatgcttcaaacttaaaaactaccaagtatagtatatattaac |
45546621 |
T |
 |
Q |
101 |
tcttgcttcaaacaaaatgatatgatacctggatatggttcgacgttaggtgagttttgttcatcgttctccccttccacat |
182 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45546622 |
tcttgcttcaaacaaaatgatatgatacctggatatggttcaacgttaggtgagttttgttcatcgttctccccttccacat |
45546703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1815 times since January 2019
Visitors: 3091