View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0401_high_9 (Length: 227)
Name: NF0401_high_9
Description: NF0401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0401_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 29680988 - 29680841
Alignment:
Q |
1 |
ccaaaggaacaaagttccccaccatgcaagatgttttcggtccccgacggtaaggccgagacccttcagatccaatgactcgccatcttcaacttgaacc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29680988 |
ccaaaggaacaaagttccccaccatgcaagatgttttcggtccccgacggtaaggccgagacccttcagatccaatgactcgccatcttcaacttgaacc |
29680889 |
T |
 |
Q |
101 |
attatatttatatctacgtctgtgttttaattttcaagcaaatgaaag |
148 |
Q |
|
|
||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
T |
29680888 |
attatatttatatttaggtctgtgttttaattttcaagcaaatgaaag |
29680841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 29667628 - 29667481
Alignment:
Q |
1 |
ccaaaggaacaaagttccccaccatgcaagatgttttcggtccccgacggtaaggccgagacccttcagatccaatgactcgccatcttcaacttgaacc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29667628 |
ccaaaggaacaaagttccccaccatgcaagatgttttcgctccccgacggtaaggccaagacccttcagatccaatgactcgccatcttcaacttgaacc |
29667529 |
T |
 |
Q |
101 |
attatatttatatctacgtctgtgttttaattttcaagcaaatgaaag |
148 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
29667528 |
attatatttatattcacgtctgtgttttaattttcaagcaaatgaaag |
29667481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 29686777 - 29686642
Alignment:
Q |
11 |
aaagttccccaccatgcaagatgttttcggtccccgacggtaaggccgagacccttcagatccaatga--ctcgccatcttcaacttgaaccattatatt |
108 |
Q |
|
|
||||||||| |||||||||||||||||||||| ||| || ||||||| ||||| |||||||| || |||||||||||||||||| ||| ||||||| |
|
|
T |
29686777 |
aaagttccctaccatgcaagatgttttcggtcaccggcgataaggccaagacc---aagatccaaggactctcgccatcttcaacttgcaccgttatatt |
29686681 |
T |
 |
Q |
109 |
tatatctacgtctgtgttttaattttcaagcaaatgaaa |
147 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
T |
29686680 |
tatatctaggtctgtgttttaattttcaagcaaatgaaa |
29686642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University