View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0401_low_10 (Length: 251)

Name: NF0401_low_10
Description: NF0401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0401_low_10
NF0401_low_10
[»] chr2 (1 HSPs)
chr2 (30-141)||(44542516-44542627)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 30 - 141
Target Start/End: Original strand, 44542516 - 44542627
Alignment:
30 tgattacgtatcagttttaataaattagaaatttaatcattagcttaaacgtcaatgatgtagattaagatacatgtgtattctaatcactttgattttg 129  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
44542516 tgattacgtatcagtttcaataaattagaaatttaatcattaacttaaacgtcaatgatgtagattaagatacatgtgtattctaatcactttaattttg 44542615  T
130 tcgaatttcaac 141  Q
    ||||||||||||    
44542616 tcgaatttcaac 44542627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1491 times since January 2019
Visitors: 3089