View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0401_low_10 (Length: 251)
Name: NF0401_low_10
Description: NF0401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0401_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 30 - 141
Target Start/End: Original strand, 44542516 - 44542627
Alignment:
Q |
30 |
tgattacgtatcagttttaataaattagaaatttaatcattagcttaaacgtcaatgatgtagattaagatacatgtgtattctaatcactttgattttg |
129 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
44542516 |
tgattacgtatcagtttcaataaattagaaatttaatcattaacttaaacgtcaatgatgtagattaagatacatgtgtattctaatcactttaattttg |
44542615 |
T |
 |
Q |
130 |
tcgaatttcaac |
141 |
Q |
|
|
|||||||||||| |
|
|
T |
44542616 |
tcgaatttcaac |
44542627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University