View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0401_low_14 (Length: 205)
Name: NF0401_low_14
Description: NF0401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0401_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 49437366 - 49437469
Alignment:
| Q |
1 |
atggaagatcttattgagatagaattcaaagttgcatatgtgtagtttataaatgatcctaagactatacatgatcatcccctttgttttacctctaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49437366 |
atggaagatcttattgagatagaattcaaagttgcatatgtgtagtttataaatgatcctaagactatacatgatcatcccctttgttttacctctaaca |
49437465 |
T |
|
| Q |
101 |
aatg |
104 |
Q |
| |
|
|||| |
|
|
| T |
49437466 |
aatg |
49437469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1751 times since January 2019
Visitors: 3091