View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0402_high_1 (Length: 330)
Name: NF0402_high_1
Description: NF0402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0402_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 32467427 - 32467226
Alignment:
| Q |
1 |
gaaaaagaagtataatattacagtttacccttcctggtgatggcttactccaactgacaacatgtcttccatcgaccatcatgagcattatcgttcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32467427 |
gaaaaagaagtataatattacagtttacccttcctgatgatggcttactccatctgacaacatgtcttccatcgaccatcatgagcattatcgttcaaca |
32467328 |
T |
|
| Q |
101 |
acataagattgagcagcaatcacagtatgccatactatgtgattcctttgcgtccataaagtccatgcaaacagcgtagcttcttcaacaattatagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||| ||| |||||||| |||||||||||| ||| |
|
|
| T |
32467327 |
acataagattgagcagcaatcacagtattccatactatgttattcctttgcttccataaagtccatgcaagcagtgtagcttcatcaacaattatatttt |
32467228 |
T |
|
| Q |
201 |
ac |
202 |
Q |
| |
|
|| |
|
|
| T |
32467227 |
ac |
32467226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 198 - 310
Target Start/End: Original strand, 32467596 - 32467708
Alignment:
| Q |
198 |
tttactagttttggaatttttaggttatgcttgtgttagaggacaaacaaataagatagtttaatagttaaagtttccttatctcaccatagcatttata |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32467596 |
tttactagttttggaatttttaggttatgcttgtgttagaggacaaacaaataagatagtttaatagttaaagtttccttatctcaccatagcatttata |
32467695 |
T |
|
| Q |
298 |
tttttgatgatgt |
310 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
32467696 |
ttttttatgatgt |
32467708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 747 times since January 2019
Visitors: 3064