View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0402_high_7 (Length: 251)
Name: NF0402_high_7
Description: NF0402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0402_high_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 32466946 - 32467168
Alignment:
| Q |
29 |
ataacaagagctgaaatgctcctattattgtctcgttttttataaggttatgtctaaaattgttaatctctatataatttggttctttaagataaattgt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32466946 |
ataacaagagctgaaatgctcctattattgtctcgttttttataaggttatgtctaaaattgttaatctctatataatttggttctttaagataaattgt |
32467045 |
T |
|
| Q |
129 |
gtcttatgtgatgataatgatggggatagtcttcatgtgttttataatgaggagagtcttcatgtgnnnnnnnaaatgttccaatagctcttatgtttgg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
32467046 |
gtcttatgtgatgataatgatggggatagtcttcatgtgttttataatgaggagagtcttcatgtgtttttttaaatgttccaatagctctaatgtttgg |
32467145 |
T |
|
| Q |
229 |
taactttgatctctttcaactat |
251 |
Q |
| |
|
||| |||| |||||||||||||| |
|
|
| T |
32467146 |
taaatttgctctctttcaactat |
32467168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1245 times since January 2019
Visitors: 3078