View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0402_low_2 (Length: 330)
Name: NF0402_low_2
Description: NF0402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0402_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 32467403 - 32467504
Alignment:
| Q |
1 |
aactgtaatattatacttctttttcctcctttcacaacataatgattttctccatttatgatgtacatgttggagaagctcgtgacttactttcaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32467403 |
aactgtaatattatacttctttttcctcctttcacaacataatgattttctccatttatgatgtacatgttggagaagctcgtggcttactttcaactct |
32467502 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
32467503 |
ta |
32467504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 220 - 310
Target Start/End: Original strand, 32467618 - 32467708
Alignment:
| Q |
220 |
ggttatgcttgtgttagaggacaaacaaataagatagtttaatagttaaagtttccttatctcaccatagcatttatatttttgatgatgt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32467618 |
ggttatgcttgtgttagaggacaaacaaataagatagtttaatagttaaagtttccttatctcaccatagcatttatattttttatgatgt |
32467708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University