View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0402_low_4 (Length: 268)
Name: NF0402_low_4
Description: NF0402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0402_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 131 - 212
Target Start/End: Original strand, 31832628 - 31832709
Alignment:
Q |
131 |
ttttaatggggtgatgtgaaagagtcttctgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31832628 |
ttttaatggggtgatgtgaaagagtcttctgaatgaaaactgaagctgaggatttgatgggtaggattggattggtggatca |
31832709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 31832516 - 31832568
Alignment:
Q |
19 |
catcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt |
71 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31832516 |
catcatcaccatcattgttcttgacaccacgtagttcaagtattgttgtagtt |
31832568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University