View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0402_low_7 (Length: 252)
Name: NF0402_low_7
Description: NF0402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0402_low_7 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 29 - 252
Target Start/End: Original strand, 32466946 - 32467169
Alignment:
Q |
29 |
ataacaagagctgaaatgctcctattattgtctcgttttttataaggttatgtctaaaattgttaatctctatataatttggttctttaagataaattgt |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32466946 |
ataacaagagctgaaatgctcctattattgtctcgttttttataaggttatgtctaaaattgttaatctctatataatttggttctttaagataaattgt |
32467045 |
T |
 |
Q |
129 |
gtcttatgtgatgataatgatggggatagtcttcatgtgttttataatgaggagagtcttcatgtgnnnnnnnaaatgttccaatagctcttatgtttgg |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
T |
32467046 |
gtcttatgtgatgataatgatggggatagtcttcatgtgttttataatgaggagagtcttcatgtgtttttttaaatgttccaatagctctaatgtttgg |
32467145 |
T |
 |
Q |
229 |
taaatttgatctctttcaactatt |
252 |
Q |
|
|
|||||||| ||||||||||||||| |
|
|
T |
32467146 |
taaatttgctctctttcaactatt |
32467169 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University