View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_12 (Length: 424)
Name: NF0403_high_12
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 30 - 355
Target Start/End: Complemental strand, 52727199 - 52726874
Alignment:
Q |
30 |
cagaagtggtagagaggggattgcatatagtgaaggagtacttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagtcttgggttgg |
129 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52727199 |
cagaagtcgtagagaggggattgcatatagtgaaggagtacttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagtcttgggttgg |
52727100 |
T |
 |
Q |
130 |
aaggttggtcaagtatggaacattcaatgttagaagtggagctcgtgaagaacatgaggctttcatcctccccgagtataatcgttcaatcgatggactt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52727099 |
aaggttggtcaagtatggaacattcaatgttagaagtggagctcgtgaagaacatgaggctttcatcctccccgagtataatcgttcaatcgatggactt |
52727000 |
T |
 |
Q |
230 |
gcttctccccgtcatatggggatgttttcacctcgtcgcctcttctcccctcgtaattacttcagcaactgaggaaaatttatatgttttctaatgtact |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
52726999 |
gcttctccccgtcatatggggatgttttcacctcgtcgcctcttctcccctcgtaattacttcagcaactgaggaaaatttatatgtttcctaatgtact |
52726900 |
T |
 |
Q |
330 |
tgtttcattagccgggttgcatgcac |
355 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
52726899 |
tgtttcattagccgggttgcatgcac |
52726874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 379 - 415
Target Start/End: Complemental strand, 52726850 - 52726814
Alignment:
Q |
379 |
gggattggctaggttgaactttagctattttctctgc |
415 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
52726850 |
gggattggctaggttgaactttagctattttctctgc |
52726814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1446 times since January 2019
Visitors: 3084