View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_23 (Length: 345)
Name: NF0403_high_23
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 30 - 332
Target Start/End: Complemental strand, 11710412 - 11710110
Alignment:
Q |
30 |
ctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaactggtga |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11710412 |
ctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaactggtga |
11710313 |
T |
 |
Q |
130 |
ctcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcattgtag |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11710312 |
ctcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcattgtag |
11710213 |
T |
 |
Q |
230 |
tgtttggcattataagatggaggacaactctgcagagnnnnnnncacgtaacagctatttagttgctgaaaattcctccaacaaaatgacatacatttta |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11710212 |
tgtttggcattataagatggaggacaactctgcagagaaaaaaacacgtaacagctatttagttgctgaaaattcctccaacaaaatgacatacatttta |
11710113 |
T |
 |
Q |
330 |
gta |
332 |
Q |
|
|
||| |
|
|
T |
11710112 |
gta |
11710110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University