View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_24 (Length: 336)
Name: NF0403_high_24
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 79 - 302
Target Start/End: Complemental strand, 31870458 - 31870235
Alignment:
Q |
79 |
cagagaaggccaagaagaaaggggaagctttagatggttcattggcgatggagatatcgccggcggatttggataatgtgaaggagaagaaggaattgat |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
31870458 |
cagagaaggccaagaagaaaggggaagctttagatggttcattggcgatggagatatcgcccgcggatttggataatgtgaaggagaagaaggaattgat |
31870359 |
T |
 |
Q |
179 |
ggaggagagatgtgctgcttattggactacattggctcctaatgtggaggattatagtggaaccgcggcgaagctgatcgcggccggttctggtcaattg |
278 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31870358 |
ggaggagagatgtgctgcctattggactacattggctcctaatgtggaggattatagtggaaccgcggcgaagctgatcgcggccggttctggtcaattg |
31870259 |
T |
 |
Q |
279 |
gttaaagggattttgtggtgtggg |
302 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
31870258 |
gttaaagggattttgtggtgtggg |
31870235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 8851494 - 8851574
Alignment:
Q |
158 |
gaaggagaagaaggaattgatggaggagagatgtgctgcttattggactacattggctcctaatgtggaggattatagtgg |
238 |
Q |
|
|
|||| |||||||||| ||||||||| | |||||| || ||||||||||||||||| || ||||||||||| |||||||| |
|
|
T |
8851494 |
gaagaagaagaaggagatgatggaggggcaatgtgcggcgtattggactacattggcaccgaatgtggaggagtatagtgg |
8851574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 240
Target Start/End: Complemental strand, 27878466 - 27878417
Alignment:
Q |
191 |
tgctgcttattggactacattggctcctaatgtggaggattatagtggaa |
240 |
Q |
|
|
||||||||||||||| || ||||| || || ||||||||||||||||||| |
|
|
T |
27878466 |
tgctgcttattggacaacgttggcaccaaacgtggaggattatagtggaa |
27878417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 803 times since January 2019
Visitors: 3065