View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_31 (Length: 313)
Name: NF0403_high_31
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 226 - 303
Target Start/End: Original strand, 27605136 - 27605213
Alignment:
Q |
226 |
atttggagtctttaatataacaaggagaaattgttcttaagaaatagttatttttgtcataagtttttgcggtctgtg |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
T |
27605136 |
atttggagtctttaatataacaaggagaaattgttcttaataaatagttattttggtcataagtttttgcggtctgtg |
27605213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University