View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_32 (Length: 311)
Name: NF0403_high_32
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0403_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 30 - 299
Target Start/End: Original strand, 44188348 - 44188617
Alignment:
| Q |
30 |
gtgacagtaagtaatatgagaagaaactgcatgactccagtctccaggctctggatgtggagtgtggaccttctatcatcactatcataggtccaattag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188348 |
gtgacagtaagtaatatgagaagaaactgcatgactccagtctccagcctctggatgtggagtgtggaccttctatcatcactatcataggtccaattag |
44188447 |
T |
|
| Q |
130 |
cattacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaaagaattcttttgacaacat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188448 |
cattacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaaagaattcttttgacaacat |
44188547 |
T |
|
| Q |
230 |
tctaatgagattgcaaatgcagtagttgggacataatttgccataccttgttcatacaataaccaatctc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188548 |
tctaatgagattgcaaatgcagtagttgggacataatttgccataccttgttcatacaataaccaatctc |
44188617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 30 - 210
Target Start/End: Original strand, 1329586 - 1329761
Alignment:
| Q |
30 |
gtgacagtaagtaatatgagaagaaactgcatgactccagtctccaggctctggatgtggagtgtg--gaccttctatcatcactatcataggtccaatt |
127 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||| | |
|
|
| T |
1329586 |
gtgacagtaagtaatatgagtagaaactacatgactccag-------gctctggatgtggagtgttttgaccttttatcatcactatcataggtccaact |
1329678 |
T |
|
| Q |
128 |
agcattacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaa |
210 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||| ||||||| || |||||||| |||||||||||| |
|
|
| T |
1329679 |
agcattacaaaatgctggcagactaaggcaagtttgttggctgctaaacgagaccaaaattagtggtcccattgagatatcaa |
1329761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 864 times since January 2019
Visitors: 3069