View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_41 (Length: 252)
Name: NF0403_high_41
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 10 - 248
Target Start/End: Complemental strand, 31870583 - 31870345
Alignment:
Q |
10 |
agaagaagataattcggatttgcttagctacggattaacgattgcgtcgaaaggacaagaggatttggtgaaggagcttgatgaagttttgaaggaatgc |
109 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31870583 |
agaagaggataattcggatttgcttagctacggattaacgattgcgtcgaaaggacaagaggatttggtgaaggagcttgatgaagttttgaaggaatgc |
31870484 |
T |
 |
Q |
110 |
agcaatttctctgttcaggaggtttcagagaaggccaagaagaaaggggaagctttagatggttcattggcgatggagatatcgccggcggatttggata |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
31870483 |
agcaatttctctgttcaggaggtttcagagaaggccaagaagaaaggggaagctttagatggttcattggcgatggagatatcgcccgcggatttggata |
31870384 |
T |
 |
Q |
210 |
atgtgaaggagaagaaggaattgatggaggagagatgtg |
248 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31870383 |
atgtgaaggagaagaaggaattgatggaggagagatgtg |
31870345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University