View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_high_44 (Length: 247)
Name: NF0403_high_44
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 229
Target Start/End: Complemental strand, 38090303 - 38090086
Alignment:
Q |
12 |
atgaaggtgtgtttgggaaataggtaacttctgagattggattagaagattctgaatagagagaaagacactgaagaagggtattattggtattaatatt |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38090303 |
atgaaggtgtgtttgggaaataggtaacttctgagattggattagaagattctgaatagagagaaagacactgaagaagggtattattggtattaatatt |
38090204 |
T |
 |
Q |
112 |
attatgttggagcacagaatctgaagaagacactggtactagaatgtggaatactaagaagaatggaacaagggatgctacaattgtatgcatcttaaca |
211 |
Q |
|
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38090203 |
attatgttggatcaaagaatctgaagaagacactggtactagaatgtggaatactaagaagaatggaacaagggatgctacaattgtatgcatcttaaca |
38090104 |
T |
 |
Q |
212 |
ggaaaaagattgagaatt |
229 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
38090103 |
ggaaaaagattgagaatt |
38090086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1644 times since January 2019
Visitors: 3091