View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0403_high_46 (Length: 209)

Name: NF0403_high_46
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0403_high_46
NF0403_high_46
[»] chr8 (1 HSPs)
chr8 (8-160)||(37571822-37571974)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 8 - 160
Target Start/End: Complemental strand, 37571974 - 37571822
Alignment:
8 aaattcggttgaccgggagaacccgtattgttactgctatgcggatattagttactgctaaacggcaatgaaaacttcctatttataacatggtaaccnn 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||      
37571974 aaattcggttgaccgggagaacccgtattgttactgctatgcggatattagttactgctaaacagcaatgaaaacttcctatttataacatggtaaccaa 37571875  T
108 nnnnntctaaaactattgtaattaaacaatgatcacaaactaattggtgtaaa 160  Q
         |||||||||||||| |||||||| ||||||||||||||||||||||||    
37571874 aaaaatctaaaactattgtgattaaacagtgatcacaaactaattggtgtaaa 37571822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1792 times since January 2019
Visitors: 3091