View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0403_low_23 (Length: 345)

Name: NF0403_low_23
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0403_low_23
NF0403_low_23
[»] chr5 (1 HSPs)
chr5 (30-332)||(11710110-11710412)


Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 30 - 332
Target Start/End: Complemental strand, 11710412 - 11710110
Alignment:
30 ctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaactggtga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11710412 ctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaactggtga 11710313  T
130 ctcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcattgtag 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11710312 ctcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcattgtag 11710213  T
230 tgtttggcattataagatggaggacaactctgcagagnnnnnnncacgtaacagctatttagttgctgaaaattcctccaacaaaatgacatacatttta 329  Q
    |||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11710212 tgtttggcattataagatggaggacaactctgcagagaaaaaaacacgtaacagctatttagttgctgaaaattcctccaacaaaatgacatacatttta 11710113  T
330 gta 332  Q
    |||    
11710112 gta 11710110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 559 times since January 2019
Visitors: 3061