View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0403_low_31 (Length: 313)

Name: NF0403_low_31
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0403_low_31
NF0403_low_31
[»] chr6 (1 HSPs)
chr6 (226-303)||(27605136-27605213)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 226 - 303
Target Start/End: Original strand, 27605136 - 27605213
Alignment:
226 atttggagtctttaatataacaaggagaaattgttcttaagaaatagttatttttgtcataagtttttgcggtctgtg 303  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||    
27605136 atttggagtctttaatataacaaggagaaattgttcttaataaatagttattttggtcataagtttttgcggtctgtg 27605213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University