View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_low_41 (Length: 253)
Name: NF0403_low_41
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0403_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 40870460 - 40870703
Alignment:
Q |
1 |
atatacataatcattaactcgaaaaataactcttgaaatttcaagcatttcataatttgtcgcatgtgtacataaattttgttacaatattaatttcttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40870460 |
atatacataatcattaactcgaaaaataactcttgaaatttcaagcatttcataatttgtcgcatgtgtacataaattttgttacaatattaatttcttt |
40870559 |
T |
 |
Q |
101 |
catctttgcactatatattactcttctcaattttagatgagccaaatatgattctaaatttgttaattgcgttctaaactctcgatgaagtaccttgtcg |
200 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
40870560 |
catctttgcactatgtattactcttctcaattttagatgagccaaatatgattctaaatttgttaattgcgttctaaactcttgatgaagtaccttgtcg |
40870659 |
T |
 |
Q |
201 |
cacacgtgttcctacttaatataatttgagaaattagtctctgc |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40870660 |
cacacgtgttcctacttaatataatttgagaaattagtctctgc |
40870703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 748 times since January 2019
Visitors: 3064