View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0403_low_43 (Length: 250)
Name: NF0403_low_43
Description: NF0403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0403_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 43613080 - 43612847
Alignment:
| Q |
9 |
ataattctaggatctgtgttttcaacttaaaatataattttaccgatgtagcatcaacacttcaaatgaaagtgcgtttaatgtctaacatgtgttagtg |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43613080 |
ataactctaggatctgtgttttcaacttaaaatataattttacggatgtagcatcaacacttcaaatgaaagtgcgtctaatgtctaacatgtgtcagtg |
43612981 |
T |
 |
| Q |
109 |
ttatatcgtgcatgtgtctgtactt-catataattttattactggtttcttgtttgatcagttgatggttttaacattgaattggtgaatttacttgcag |
207 |
Q |
| |
|
| |||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612980 |
tcatatcgtgtatgtgtctgtacttacatataattttattactgatttcttgtttgatcagttgatggttttaacattgaattggtgaatttacttgcag |
43612881 |
T |
 |
| Q |
208 |
tcctatccatcaatggcagatttccagaaatcag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43612880 |
tcctatccatcaatggcagatttccagaaatcag |
43612847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University